Question Number: 210
PDR Number: SQ22-000580
Date Submitted: 21/11/2022
Department or Body: Department of Health
204 A variation of 50% would not be accepted by the Therapeutic Goods Administration (TGA) and is not. The results of the in vitro translation test (i.e. protein production by translated vaccine mRNA) are monitored through the TGA batch release process. The viral spike (S) protein of SARS-CoV-2 is reported in the literature as having a molecular weight of 143kDa (deglycosylated form). Being a complex glycoprotein there is inherent variability in the molecules weight due to the incorporation of host derived glycans giving a measured range of 180 – 200kDa. For mRNA vaccines, an in vitro translation (methionine labelling) test is performed to confirm the mRNA active ingredient produces the viral spike (S) protein of SARS-CoV-2. The translated protein must be within the acceptable molecular weight range of ±10 per cent (not 50%) before its release for supply. 221 Both TGA-provisionally approved Pfizer (COMIRNATY) and Moderna (SPIKEVAX) vaccines consist of N1-methyl-pseudouridine(Ψ) modified (N1-methyl-Ψ) mRNA encoding the SARS-COVID-19 spike protein. N1-methylpseudouridine is a naturally occurring modified nucleotide, highly abundant and naturally widespread in cells and its use does not change its mRNA features. Scientists globally consider these products as mRNA and have done so long before the emergence of COVID-19 vaccines. N1-methyl-pseudouridine is used in the Pfizer and Moderna mRNA vaccines to ensure translation efficacy, stability and safety of the mRNA vaccines based on the well-established use of pseudouridine in the development of mRNA therapeutics (References 1, 2, 5, reviewed in 3 and 4 below). 267 The two mRNA vaccines (Pfizer (COMIRNATY) and Moderna (SPIKEVAX)) are technologically very similar. They contain codon-optimized sequences for efficient expression of the full-length S protein and use the authentic signal peptide sequence for its biosynthesis. The sequence consists of: a five prime cap at the start of the sequence, a five prime untranslated region, the open reading frame (translated sequence), a three prime untranslated region and a polyadenosine tail. The vaccine mRNA syntax starts with a cap (GA) followed by 5’ untranslated region (‘UTR’). 5’-UTR contains the sequence (52 nucleotides) for the ribosome landing. This is also known as ribosome binding site (RBS). The design of proper 5′ and 3′ UTRs sequences is crucial for the success of mRNA vaccines. Many investigations have been conducted to screen and design the most effective 5′ and 3′ UTR sequences for mRNA vaccines. Fang et al., 2022 summarises current UTR sequences of COVID-19 mRNA vaccines from different vaccine manufacturers (Reference 6 below). The following is the UTR used in the Pfizer mRNA vaccine (Reference 6 below). GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC T has been replaced by pseudouridine (Ψ). GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC 289 mRNAs are rapidly broken down by nucleases in mammalian, bacterial and yeast cells (Reference 9 below). Due to the rapid degradation of mRNA, vaccine mRNAs are delivered in lipid nanoparticles, which protect the mRNA from being broken down by nucleases and help deliver the mRNA into cells. Pseudouridine-modified mRNA could be more resistant to RNase L-mediated degradation (Reference 7 below). Because RNase L is a 2′-5′- oligoadenylate synthetase-dependent ribonuclease, the ability of pseudouridylated mRNA to limit the activity of 2′-5′-oligoadenylate synthetase could provide an advantage to pseudouridine-modified mRNA over unmodified mRNA. The reason behind the use of pseudouridine in the Pfizer and Moderna mRNA vaccines was to ensure translation efficacy, stability and safety of the mRNA (reviewed in 3, 4) as well as the reduction of immunogenicity. There are no data specifically on the degradation of COVID-19 vaccine mRNAs in laboratory animals or humans. mRNAs in an mRNA-based cytomegalovirus (CMV) vaccine developed using the same platform as the Moderna COVID-19 vaccine was rapidly eliminated from tissues with half-lives of 15-60 h in rats. The vaccine mRNAs were mainly retained at the injection site, with moderate distribution to local lymph nodes and spleen; only a relatively small fraction of the administered mRNA dose is distributed to distant tissues. The mRNA constructs did not persist beyond one to three days in tissues except for the injection site muscle, lymph nodes and spleen (detectable five days after dosing). The COVID-19 vaccine mRNA should also be broken down rapidly in humans after the vaccine injection. References (1) Pardi N., Parkhouse K., Kirkpatrick E., McMahon M., Zost S.J., Mui B.L. et al. (2018) Nucleoside-modified mRNA immunization elicits influenza virus hemagglutinin stalkspecific antibodies. Nat. Commun. 9: 3361. (2) Pardi N., Secreto A.J., Shan X., Debonera F., Glover J., Yi Y. et al. (2017) Administration of nucleoside-modified mRNA encoding broadly neutralizing antibody protects humanized mice from HIV-1 challenge. Nat. Commun. 8: 14630. (3) Morais P., Adachi H. and Yu Y.T. (2021) The Critical Contribution of Pseudouridine to mRNA COVID-19 Vaccines. Front. Cell Dev. Biol. 9: 789427. (4) Nance K.D. and Meier J.L. (2021) Modifications in an Emergency: The Role of N1- Methylpseudouridine in COVID-19 Vaccines. ACS Cent. Sci. 7: 748–756. (5) Dolgin E. (2021) CureVac COVID vaccine let-down spotlights mRNA design challenges. Nature 594: 483. (6) Fang, E., Liu, X., Li, M. et al. (2022). Advances in COVID-19 mRNA vaccine development. Sig. Transduct. Target Ther. 7, 94 (7) Anderson, B. R., Muramatsu, H., Jha, B. K., Silverman, R. H., Weissman, D., and Kariko, K. (2011). Nucleoside Modifications in RNA Limit Activation of 2′-5′-oligoadenylate Synthetase and Increase Resistance to Cleavage by RNase L. Nucleic Acids Res. 39, 9329– 9338. (8) Park, J. W., Lagniton, P. N. P., Liu, Y., & Xu, R. H. (2021). mRNA vaccines for COVID-19: what, why and how. Int, J. Biol. Sci. 17(6), 1446–1460. (9) Yang E., van Nimwegen E., Zavolan M., Rajewsky N., Schroeder M., Magnasco M. et al. (2003) Decay rates of human mRNAs: correlation with functional characteristics and sequence attributes. Genome Res. 13: 1863–1872.
